anti-doping comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Updated 2026-04-27. Numbers and descriptions here follow the published literature rather than marketing material.
The fragment includes residues that can form an internal disulfide bond between two cysteine positions. This structural feature can influence how the peptide folds and how stable it is in solution. AOD-9604 differs from full-length hGH in size and receptor interactions; it does not contain the entire growth hormone sequence. Published descriptions sometimes use slightly different residue numbering, so sequence information should be checked against primary sources. The molecule is small compared with intact hGH, which affects analytical detection and purification approaches.
Interest in AOD-9604 arose from attempts to separate metabolic effects from growth effects attributed to hGH. Early work explored whether the fragment could influence lipolysis or fat oxidation without promoting growth. Those questions remain partly unresolved because human data are limited and results have varied across studies. The peptide is not a hormone replacement for hGH and is not equivalent to hGH in clinical use. Its research history includes both laboratory studies and commercial marketing claims that are not the same as regulatory approval.
AOD-9604 is a synthetic peptide whose structure corresponds to a C-terminal segment of human growth hormone. It is often described as hGH fragment 176-191, a 16-amino-acid sequence. The peptide was designed to isolate a region of hGH associated with fat metabolism while avoiding the full hormone's growth-promoting actions. Laboratory and commercial materials typically present it as a lyophilized powder for research use. Its identity is defined by amino acid sequence, not by a single brand.
Quality varies among research-grade suppliers, so certificates of analysis and independent testing are important for verification. A typical certificate reports purity by HPLC, identity by mass spectrometry, appearance, and sometimes residual solvents or water content. AOD9604 is often sold as a research chemical not intended for human consumption, and labels can be inaccurate. Common misconceptions include treating the peptide as a form of growth hormone, assuming supplement status, or expecting approved-drug quality from unregulated products.
AOD9604 is commonly supplied as a white to off-white lyophilized powder. The powder is typically stored at -20 °C or below, protected from light and moisture, because peptides can degrade through oxidation, hydrolysis, or aggregation. If it is reconstituted for laboratory use, an appropriate aqueous buffer or solvent is chosen, and the solution is kept cold and handled to avoid repeated freeze-thaw cycles. These practices support stability but do not imply suitability for human use.
Identity and purity are usually assessed with reversed-phase high-performance liquid chromatography and mass spectrometry. Reversed-phase HPLC separates the peptide from related impurities and can estimate purity by ultraviolet absorbance, while mass spectrometry confirms the molecular mass and detects modifications. Peptide mapping, amino acid analysis, and disulfide mapping may be used when the sequence or disulfide arrangement must be verified. Because AOD9604 contains cysteine residues, oxidation and disulfide isomers are possible quality concerns in synthetic batches.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide | Based on the C-terminal region of human growth hormone. |
| Amino acid length | 16 residues | Often described as hGH fragment 176-191. |
| Appearance | Lyophilized powder | Typically white to off-white; exact appearance depends on grade. |
| Solubility | Soluble in water | Aqueous solubility depends on pH, ionic strength, and preparation. |
| Typical storage | -20 °C or lower | Lyophilized peptide is usually kept cold and dry; solutions may require freezing. |
Regulatory treatment of AOD-9604 has varied. In sports anti-doping, the peptide became widely discussed during a 2013 investigation into an Australian professional sports club. Authorities at the time debated whether it fell under prohibitions on growth hormone and related substances. Later clarifications and updated lists have addressed the compound in different ways. Anyone seeking current status should consult the latest applicable rules, and commercial supply for human use is not authorized in major markets.
Research interest in AOD-9604 often focuses on whether it can influence lipid metabolism without the growth-promoting or glucose-related effects of full-length hGH. This question remains unresolved, and findings depend on model, dose, and measurement method. Some reviews treat the peptide as a historical obesity candidate rather than an active therapeutic. Others cite it in discussions of peptide fragments, metabolic signaling, and performance-enhancing substances. Clear conclusions are limited by the small number of rigorous, independent human studies.
Regulatory treatment of AOD-9604 is shaped by its classification as a peptide hormone. The World Anti-Doping Agency lists it as a prohibited substance, and many national anti-doping organizations adopt that list. It does not hold approval as a prescription medicine in the United States, the European Union, or other major markets. Products sold online are frequently labeled for research use only and may not undergo independent quality testing. Import and possession rules differ by country, so legal status depends on local law.
Proposed mechanisms for AOD-9604 focus on fat cells. Laboratory studies suggest the peptide can increase lipolysis, the breakdown of stored fat, and reduce lipogenesis, the formation of new fat. Unlike full human growth hormone, it does not appear to stimulate substantial IGF-1 production in the studies reported so far. Some evidence points to beta-adrenergic signaling, but the precise receptor targets and downstream pathways remain unresolved. The fragment is not thought to act through the classical growth hormone receptor.
The carnitine shuttle is a biochemical reaction used to transport long chain fatty acids (LCFAs) from the cytosol into the matrix of the mitochondria so that they may be metabolized. While some fatty acids can, long chain fatty acids cannot pass through the mitochondrial membrane. However, carnitine (specifically its stereoisomer l-carnitine) can. The shuttle utilizes this to its advantage by attaching the LCFAs to carnitine. This new acyl-carnitine can pass through the membrane, after which it is split, with the newly separated carnitine being sent back out to shuttle more LCFAs, and the newly separated LCFAs undergoing beta oxidation to release their energy. The carnitine shuttle is an example of an antiporter system, and is a part of the broader class of metabolic reactions that constitute lipid metabolism. It is a highly conserved system found primarily in animals/some eukaryotes, although bacteria and plants still use carnitine for other things such as being an osmoprotectant, or being and electron acceptor in the electron transport chain. The shuttle system is implicated in many metabolic disorders, in the form of deficiencies of the enzymes in the system.
Most of the turquoise deposits in Nevada occur along a wide belt of tectonic activity that coincides with the state's zone of thrust faulting. It strikes at a bearing of about 15° and extends from the northern part of Elko County, southward down to the California border southwest of Tonopah. Nevada has produced a wide diversity of colours and mixes of different matrix patterns, with turquoise from Nevada coming in various shades of blue, blue-green, and green. Some of this unusually-coloured turquoise may contain significant zinc and iron, which is the cause of the beautiful bright green to yellow-green shades. Some of the green to green-yellow shades may actually be variscite or faustite, which are secondary phosphate minerals similar in appearance to turquoise. A significant portion of the Nevada material is also noted for its often attractive brown or black limonite veining, producing what is called "spiderweb matrix". While a number of the Nevada deposits were first worked by Native Americans, the total Nevada turquoise production since the 1870s has been estimated at more than 600 short tons (540 t), including nearly 400 short tons (360 t) from the Carico Lake mine. In spite of increased costs, small scale mining operations continue at a number of turquoise properties in Nevada, including the Godber, Orvil Jack and Carico Lake mines in Lander County, the Pilot Mountain Mine in Mineral County, and several properties in the Royston and Candelaria areas of Esmerelda County.
G6PD is generally found as a dimer of two identical monomers (see main thumbnail). Depending on conditions, such as pH, these dimers can themselves dimerize to form tetramers. Each monomer in the complex has a substrate binding site that binds to G6P, and a catalytic coenzyme binding site that binds to NADP+/NADPH using the Rossman fold. For some higher organisms, such as humans, G6PD contains an additional NADP+ binding site, called the NADP+ structural site, that does not seem to participate directly in the reaction catalyzed by G6PD. The evolutionary purpose of the NADP+ structural site is unknown. As for size, each monomer is approximately 500 amino acids long (514 amino acids for humans). Functional and structural conservation between human G6PD and Leuconostoc mesenteroides G6PD points to three widely conserved regions on the enzyme: a nine-residue peptide in the substrate binding site, RIDHYLGKE (residues 198–206 on human G6PD), a nucleotide-binding fingerprint, GxxGDLA (residues 38–44 on human G6PD), and a partially conserved sequence EKPxG near the substrate binding site (residues 170–174 on human G6PD), where we have use "x" to denote a variable amino acid. The crystal structure of G6PD reveals an extensive network of electrostatic interactions and hydrogen bonding involving G6P, three water molecules, three lysine residues, one arginine, two histidines, two glutamic acids, and other polar amino acids. The proline at position 172 is thought to play a crucial role in positioning Lys171 correctly with respect to the substrate, G6P.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Endoxifen, also known as 4-hydroxy-N-desmethyltamoxifen, is a nonsteroidal selective estrogen receptor modulator (SERM) of the triphenylethylene group as well as a protein kinase C (PKC) inhibitor. It is under development for the treatment of estrogen receptor-positive breast cancer and for the treatment of mania in bipolar disorder. It is taken by mouth. Endoxifen is an active metabolite of tamoxifen and has been found to be effective in patients that have failed previous hormonal therapies (tamoxifen, aromatase inhibitors, and fulvestrant). The prodrug tamoxifen is metabolized by the CYP2D6 enzyme to produce endoxifen and afimoxifene (4-hydroxytamoxifen). Currently, endoxifen is approved by Drugs Controller General of India for the acute treatment of manic episode with or without mixed features of Bipolar I disorder. It is manufactured and sold by Intas Pharmaceuticals under the brand name Zonalta.
Sources: en.wikipedia.org
Gene therapy is a promising treatment for a number of diseases where a "normal" gene carried by the vector is inserted into the genome, to replace an "abnormal" gene or supplement the expression of particular gene. Viral vectors are generally used but other nonviral methods of delivery are being developed. The treatment is still a risky option due to the viral vector used which can cause ill-effects, for example giving rise to insertional mutation that can result in cancer. However, there have been promising results. Expression vectors are fundamental tools in molecular biology and biotechnology for directing the expression of cloned genes in host cells, enabling the study of gene function and the production of recombinant proteins. Due to their widespread use in research, reference expression vectors are preserved by public biological resource centres and non-profit repositories, facilitating access to standardized materials for scientists worldwide; such repositories include BCCM/GeneCorner and Addgene.
=== Insulin === Recent research has revealed that C. geographus uses a form of insulin as a means of stunning its prey. This insulin is distinct from its own (with shorter chains) and appears to be a stripped-down version of those insulins found in fish. Once this venom passes through a fish's gills, the fish experiences hypoglycaemic shock, essentially stunning it and allowing for ingestion by the snail. This poison mixture has been referred to as nirvana cabal. Besides the tulip cone snail, C. tulipa, no other species of any known lifeform is known to use its own biological insulin as a weapon.
=== Increased levels of sex hormone-binding globulin === Estrogens can increase blood levels of the protein sex hormone-binding globulin (SHBG), which binds free testosterone (the active form) more strongly than estrogen, leading to decreased testosterone action in male breast tissue. Conditions such as hyperthyroidism and chronic liver disease affect levels of SHBG, leading to symptomatic gynecomastia.
Studies indicate that the drug also acts pro-apoptotically through the CD95 receptor, which affects the activation of caspases 8 and 3. In multiple myeloma cells, arsenic trioxide interacts with the APO2/TRAIL receptor, activating caspases 8 and 9. Arsenic trioxide also affects the intracellular concentration of glutathione, which is a crucial component of the redox system (it removes radicals and reduces hydrogen peroxide). It also participates, along with peroxidase and catalase, in regulating the levels of reactive oxygen species. Arsenic trioxide inhibits glutathione peroxidase, thereby decreasing its concentration in the cell, which leads to an increase in the levels of reactive oxygen species. These, in turn, increase the permeability of the mitochondrial membrane, causing the release of apoptotic factors and initiating the apoptosis process.
Sources: en.wikipedia.org
It is a synthetic peptide based on a C-terminal fragment of human growth hormone. It is commonly referred to as hGH fragment 176-191 and is studied for metabolic effects rather than growth effects.
No. It represents only a short portion of the hGH sequence and lacks the full hormone's structure. As a result, its biological activity and regulatory status differ from those of prescription hGH.
The exact peptide is not typically described as a circulating hormone; it is a synthetic construct based on a natural sequence. Fragments of hGH can exist in laboratory or metabolic contexts, but AOD-9604 itself is manufactured for research.
Lyophilized AOD9604 is generally kept at -20 °C or colder, desiccated, and protected from light. Reconstituted solutions are usually refrigerated and handled to minimize repeated freeze-thaw cycles. These are general laboratory handling practices, not instructions for human use.